User contributions for Craig
Jump to navigation
Jump to search
- 03:35, 25 November 2014 diff hist +32 Real Vegan Cheese Notebook Training Sign-off current
- 21:21, 16 October 2014 diff hist +131 Sequencing Analysis using Serial Cloner 2-6-1 →Sequencing Analysis current
- 21:21, 16 October 2014 diff hist 0 N File:Function Align two seqs.png current
- 21:19, 16 October 2014 diff hist 0 N File:Open forward.png current
- 21:18, 16 October 2014 diff hist −12 Sequencing Analysis using Serial Cloner 2-6-1
- 21:17, 16 October 2014 diff hist 0 N File:Search for ATG.png current
- 21:16, 16 October 2014 diff hist +26 Sequencing Analysis using Serial Cloner 2-6-1
- 21:15, 16 October 2014 diff hist +944 N Sequencing Analysis using Serial Cloner 2-6-1 Created page with "= Sequencing Analysis = 1. Using Serial Cloner Freeware (2-6-1) open the forward sequencing reaction from the TEF primer. a. Search for ATG (and translate the protein by ..."
- 21:14, 16 October 2014 diff hist +51 Shared Laboratory Notebook
- 17:09, 15 October 2014 diff hist +93 Submitting FAM20C (Kex + & Kex -) for sequencing with new internal primers 14Oct2014
- 21:53, 14 October 2014 diff hist +3,105 N IGEM team meeting notes 6/2/14 Created page with "June 2nd 2014 = Agenda = == Introductions == Patrik Dmitri Shashank Maria Karen Colin Dave Teddy Advait Rebecca Avinash Geoff == Brief intro to project for new people == wi..." current
- 21:53, 14 October 2014 diff hist +3,822 N IGEM team meeting notes 6/9/14 Created page with "June 9, 2014 Attendees: Lou - New to group; DIY elec house security; found us via meetup Craig - Patrik Ahnon David Poole - SFState, studying proteins; h..." current
- 21:53, 14 October 2014 diff hist +1,497 N IGEM team meeting notes 6/16/14 Created page with "June 16, 2014 Attendees: Craig, Jamie, Ahnon, Patrik, Advait, Lou, Rachel, Rebecca, Wes, Ashley, Marc is there a link to zoom? --rebecca https://zoom.us/j/820128495 Logisti..." current
- 21:52, 14 October 2014 diff hist +1,142 N IGEM team meeting notes 6/18/14 Created page with "June 18, 2014 Crowdfunding Campaign Meeting Attendees: Ashley; Ahnon; Lou; Craig, Patrik, Marc (1) Getting a list of supporters before we launch (Compiling donors) - Writin..." current
- 21:52, 14 October 2014 diff hist +834 N IGEM team meeting notes 6/23/14 Created page with "June 23, 2014 Agenda: (1) Project Intro wiki: https://wiki.counterculturelabs.org/index.php/Vegan_cheese (2) Updates a) Cloning cloned kappa-casin into expression ..." current
- 21:52, 14 October 2014 diff hist +151 N IGEM team meeting notes 6/25/14 Created page with " June 25, 2014 (1) Campaign Page Completion Main body text - edit Photos Finalize rewards (2) Precampaign Letter (3) List of Donors (4) List of Press" current
- 21:51, 14 October 2014 diff hist +240 N IGEM team meeting notes 6/30/14 Created page with "June 30, 2014 1) Press Release: (https://docs.google.com/document/d/1MY1KPotb56e06HqNyYoZUreRH7b9vgKBmE5Bib-Cfa0/edit) -Decided title: San Francisco Bay Area Biohackers engin..." current
- 21:51, 14 October 2014 diff hist +3,574 N IGEM team meeting notes 7/7/14 Created page with "Meeting 07/07/2014 Attendees: Patrik D., Maria I., Ben, Steven, Eric, Vern, Itai, Arif, Ed, Wes, Brett, Nokolai, Lou, Teddy, Cherie, Tito, Eri, Advait, Craig, via Zoom: Ahnon..." current
- 21:50, 14 October 2014 diff hist +5,032 N IGEM team meeting notes 7/14/14 Created page with "Agenda 07/14/2014 Call in information: https://zoom.us/j/744239720 Or, go to https://zoom.us/join and enter meeting ID: 820 128 495 (Eri's meeting room) Weekly meeting:..." current
- 21:49, 14 October 2014 diff hist +4,498 N IGEM team meeting notes 7/20/14 Created page with "Agenda: 07/20/14 Call-in info: https://zoom.us/j/820128495 Or, go to https://zoom.us/join and enter meeting ID: 820 128 495 Note: Alisa Cordesius from IndieGogo may giv..." current
- 21:49, 14 October 2014 diff hist +6,465 N IGEM team meeting notes 7/28/14 Created page with "TODO 7/28/14: Ben (bottomliner) in Quartzy (https://www.quartzy.com/); Ahnon; Matt? Johan; Craig; Ben Patrik has jewelery; need to update IG Ben has camera will photograph af..." current
- 21:49, 14 October 2014 diff hist +1,474 N IGEM team meeting notes 8/4/14 Created page with "Agenda: 08/4/14 Call-in info: https://zoom.us/j/820128495 Or, go to https://zoom.us/join and enter meeting ID: 820 128 495 I. Intro/Go around (5 min - start on time!) M..." current
- 21:48, 14 October 2014 diff hist +5,426 N IGEM team meeting notes 8/11/14 Created page with "TODO 8/11/14: Johan and Cral will finalize DNA sequences, and submit - or send to Craig for submission Ryan filming the Vegan Galactase response Video Rebecca and ..." current
- 21:48, 14 October 2014 diff hist +3,390 N IGEM team meeting notes 8/18/14 Created page with "Agenda 8/18/2014 Present: Stan, Ashley, Rebecca, Rachel, Carl, Craig, Patrik, Advait, Drew https://wiki.realvegancheese.org/index.php/Protease_problems There are Kex2 protea..." current
- 21:47, 14 October 2014 diff hist +1,358 N IGEM team meeting notes 8/25/14 Created page with "Agenda 8/25/2014 Call-in info: https://zoom.us/j/820128495 Or, go to https://zoom.us/join and enter meeting ID: 820 128 495 Attendees: Advait, Patrik, Johan, Maria, Ashley,..." current
- 21:47, 14 October 2014 diff hist +1,024 N IGEM team meeting notes 9/1/14 Created page with "Agenda 9/1/2014 Call-in info: https://zoom.us/j/820128495 Or, go to https://zoom.us/join and enter meeting ID: 820 128 495 Attendees: Advait, Eri, Maria, Patrik, Johan, Mi..." current
- 21:47, 14 October 2014 diff hist +6,114 N IGEM team meeting notes 9/8/14 Created page with "Agenda 9/8/2014 Call-in info: https://zoom.us/j/820128495 Or, go to https://zoom.us/join and enter meeting ID: 820 128 495 Attendees: Patrik, Lou, Jen, Moises, Rachel, Marc..." current
- 21:46, 14 October 2014 diff hist +6,996 N IGEM team meeting notes 9/15/14 Created page with "Agenda 9/15/2014 Attendees: Advait (zoom), Patrik, Marc, Rachel, Maria, Thorson, Isaac, Rebecca, Ben, Moises, Jamie Call-in info: https://zoom.us/j/820128495 Or, go to https:..." current
- 21:45, 14 October 2014 diff hist +2,220 N IGEM team meeting notes 9/29/14 Created page with "= Meeting 9/29/2014 = regular RVC meeting and first ever board meeting at CCL; experiments being finished up at BioC Attendees: ? BioCurious: Maria, Lafia, Meenakshi, Nikola,..." current
- 21:44, 14 October 2014 diff hist +3,690 N IGEM team meeting notes 10/13/14 Created page with "= Meeting 10/13/2014 at CCL = Call-in info: https://zoom.us/j/820128495 Or, go to https://zoom.us/join and enter meeting ID: 820 128 495 hello is the zoom starting Attendees:..." current
- 21:44, 14 October 2014 diff hist +38 Real Vegan Cheese →Meeting notes
- 21:38, 14 October 2014 diff hist +185 Submitting 4 repeat and 1 new casein in pD1214 plasmid for sequencing 10Oct2014
- 18:18, 13 October 2014 diff hist 0 Submitting 4 repeat and 1 new casein in pD1214 plasmid for sequencing 10Oct2014
- 18:18, 13 October 2014 diff hist +1 Submitting 4 repeat and 1 new casein in pD1214 plasmid for sequencing 10Oct2014
- 18:18, 13 October 2014 diff hist +78 Submitting 4 repeat and 1 new casein in pD1214 plasmid for sequencing 10Oct2014
- 18:17, 13 October 2014 diff hist +15 N File:Sequencing data summary 10-11-14.png Sequencing Data current
- 02:30, 4 October 2014 diff hist +39 Real Vegan Cheese
- 15:35, 2 October 2014 diff hist +1 Submitting 10 casein and FAM20C in pD1214 plasmids for sequencing 30Sep2014
- 15:35, 2 October 2014 diff hist +6 Submitting 10 casein and FAM20C in pD1214 plasmids for sequencing 30Sep2014
- 15:34, 2 October 2014 diff hist +102 Shared Laboratory Notebook
- 23:46, 1 October 2014 diff hist 0 Submitting 10 casein and FAM20C in pD1214 plasmids for sequencing 30Sep2014
- 23:46, 1 October 2014 diff hist 0 Submitting 10 casein and FAM20C in pD1214 plasmids for sequencing 30Sep2014
- 23:46, 1 October 2014 diff hist +6 Submitting 10 casein and FAM20C in pD1214 plasmids for sequencing 30Sep2014
- 23:45, 1 October 2014 diff hist +109 Submitting 10 casein and FAM20C in pD1214 plasmids for sequencing 30Sep2014
- 23:44, 1 October 2014 diff hist 0 N File:Screen Shot 2014-10-01 at 4.42.46 PM.png current
- 11:49, 8 September 2014 diff hist +4 CLONE 082514 humKappaCasein(Kex+) →Experiment 082514_humKappaCasein(Kex+) Cloning
- 11:49, 8 September 2014 diff hist 0 File:HumanKappa(Kex+).png Craig uploaded a new version of "File:HumanKappa(Kex+).png" current
- 11:48, 8 September 2014 diff hist +2 CLONE 082514 humKappaCasein(Kex+)
- 11:48, 8 September 2014 diff hist +26 CLONE 082514 humKappaCasein(Kex+)
- 11:47, 8 September 2014 diff hist +32 CLONE 082514 humKappaCasein(Kex+)
- 11:46, 8 September 2014 diff hist 0 File:HumanKap(Kex+) Rev.png Craig uploaded a new version of "File:HumanKap(Kex+) Rev.png": Reverse direction sequencing. current
- 11:45, 8 September 2014 diff hist −32 CLONE 082514 humKappaCasein(Kex+)
- 11:44, 8 September 2014 diff hist +32 CLONE 082514 humKappaCasein(Kex+)
- 11:43, 8 September 2014 diff hist 0 File:HumanKap(Kex+) Rev.png Craig uploaded a new version of "File:HumanKap(Kex+) Rev.png"
- 11:42, 8 September 2014 diff hist −53 CLONE 082514 humKappaCasein(Kex+)
- 11:41, 8 September 2014 diff hist 0 CLONE 082514 humKappaCasein(Kex+)
- 11:39, 8 September 2014 diff hist +143 CLONE 082514 humKappaCasein(Kex+)
- 11:38, 8 September 2014 diff hist 0 N File:HumanKappa(Kex+).png
- 11:37, 8 September 2014 diff hist 0 N File:HumanKap(Kex+) Rev.png
- 06:54, 2 September 2014 diff hist +1 Shared Laboratory Notebook
- 03:44, 2 September 2014 diff hist +29 Shared Laboratory Notebook
- 03:40, 2 September 2014 diff hist +75 Shared Laboratory Notebook
- 03:39, 2 September 2014 diff hist +17 N Shared Laboratory Notebook Created page with "*DNA Handling"
- 03:39, 2 September 2014 diff hist +32 Real Vegan Cheese
- 17:56, 30 August 2014 diff hist +4 CLONE 082514 humKappaCasein(Kex+)
- 17:56, 30 August 2014 diff hist +33 CLONE 082514 humKappaCasein(Kex+) →Experiment 082514_humKappaCasein(Kex+) Cloning
- 17:54, 30 August 2014 diff hist 0 N File:Human Kappa Casein Map.png current
- 17:51, 30 August 2014 diff hist +2,162 N CLONE 082514 humKappaCasein(Kex+) Created page with "== Experiment 082514_humKappaCasein(Kex+) Cloning == *Human Kappa Casein (BB.SapI.humKappa(Kex+).SapI.BB) 5'- TACACGGAATTCGCGGCCGCTTCTAGAGGCTCTTCTATGAGATTCCCATCTATTTTCACC..."
- 17:51, 30 August 2014 diff hist +3 Cloning strategy →Experiments
- 17:50, 30 August 2014 diff hist −2 CR 082514 humKappaCasein(Kex+) →Experiment CR082514_humKappaCasein(Kex+) Cloning current
- 17:49, 30 August 2014 diff hist +2,164 N CR 082514 humKappaCasein(Kex+) Created page with "== Experiment CR082514_humKappaCasein(Kex+) Cloning == *Human Kappa Casein (BB.SapI.humKappa(Kex+).SapI.BB) 5'- TACACGGAATTCGCGGCCGCTTCTAGAGGCTCTTCTATGAGATTCCCATCTATTTTCA..."
- 17:43, 30 August 2014 diff hist +3,867 N CR 062214 humanKappaCasein 001 Created page with "== Experiment CR062214_hKappa Casein Cloning == *The sequence has been delivered! 5' - TACACGTACTTAGTCGCTGAAGCTCTTCT'''ATG'''GAAGTCCAAAACCAAAAGCAACCAGCTTGTCATGAAAACGACGAAAG..." current
- 17:43, 30 August 2014 diff hist +45 Cloning strategy →Experiments
- 17:41, 30 August 2014 diff hist −44 Cloning strategy Undo revision 495 by Craig (talk)
- 17:40, 30 August 2014 diff hist +44 Cloning strategy →Experiments
- 02:31, 30 August 2014 diff hist +584 N DNA Handling Created page with " Our cloning strategy requires 20ng of Casein-DNA in 1uL. This means we need a final concentration of DNA for cloning to be 20ng/uL. 1. Quick spin lyophilized DNA in a micro..."
- 02:26, 30 August 2014 diff hist +2 Cloning strategy →Experiments
- 02:26, 30 August 2014 diff hist +17 Cloning strategy
- 16:26, 20 August 2014 diff hist −2 Cloning strategy
- 16:25, 20 August 2014 diff hist +3,867 N Molecular Experiments Created page with "== Experiment CR062214_hKappa Casein Cloning == *The sequence has been delivered! 5' - TACACGTACTTAGTCGCTGAAGCTCTTCT'''ATG'''GAAGTCCAAAACCAAAAGCAACCAGCTTGTCATGAAAACGACGAAAG..." current
- 16:24, 20 August 2014 diff hist +43 Cloning strategy
- 16:23, 20 August 2014 diff hist −3,850 Cloning strategy →hKappa Casein Cloning
- 16:23, 20 August 2014 diff hist +93 Growth Curve Experiment
- 16:20, 20 August 2014 diff hist −4 Growth Curve Experiment
- 16:19, 20 August 2014 diff hist +141 Growth Curve Experiment
- 16:17, 20 August 2014 diff hist +13 Growth Curve Experiment
- 16:16, 20 August 2014 diff hist +2 Growth Curve Experiment
- 16:13, 20 August 2014 diff hist +391 Growth Curve Experiment
- 16:04, 20 August 2014 diff hist +1,480 N Growth Curve Experiment Created page with "Chemical transformation of yeast requires the organism to be in logarithmic growth phase, so, before we clone our casein genes into yeast, we need to make sure that we know ho..."
- 16:00, 20 August 2014 diff hist −1,350 Microbiology Replaced content with "*Growth Curve Experiment" current
- 16:00, 20 August 2014 diff hist +1,359 Microbiology
- 15:55, 20 August 2014 diff hist +19 N Microbiology Created page with "New Experiments"
- 15:55, 20 August 2014 diff hist +18 Real Vegan Cheese
- 17:25, 8 August 2014 diff hist +231 Cloning strategy →hKappa Casein Cloning
- 04:52, 6 August 2014 diff hist +69 Working Groups
- 04:50, 6 August 2014 diff hist −861 Working Groups →Budget, Inventory, Ordering
- 04:50, 6 August 2014 diff hist +33 Real Vegan Cheese →Project pages
- 04:07, 6 August 2014 diff hist +536 N IGEM cloning team meeting notes 8/05/14 Created page with "Meeting 08/05/14 Agenda (1) Strategy - Review of Milestones (2) Reagents needed (add to list below) (3) Sequencing - Rachel as point person for Sequetech (done) (4) Reporti..." current
- 04:07, 6 August 2014 diff hist +45 Real Vegan Cheese →Meeting notes
- 04:06, 6 August 2014 diff hist +145 External communications