User contributions for Craig
Jump to navigation
Jump to search
- 21:47, 14 October 2014 diff hist +1,358 N IGEM team meeting notes 8/25/14 Created page with "Agenda 8/25/2014 Call-in info: https://zoom.us/j/820128495 Or, go to https://zoom.us/join and enter meeting ID: 820 128 495 Attendees: Advait, Patrik, Johan, Maria, Ashley,..." current
- 21:47, 14 October 2014 diff hist +1,024 N IGEM team meeting notes 9/1/14 Created page with "Agenda 9/1/2014 Call-in info: https://zoom.us/j/820128495 Or, go to https://zoom.us/join and enter meeting ID: 820 128 495 Attendees: Advait, Eri, Maria, Patrik, Johan, Mi..." current
- 21:47, 14 October 2014 diff hist +6,114 N IGEM team meeting notes 9/8/14 Created page with "Agenda 9/8/2014 Call-in info: https://zoom.us/j/820128495 Or, go to https://zoom.us/join and enter meeting ID: 820 128 495 Attendees: Patrik, Lou, Jen, Moises, Rachel, Marc..." current
- 21:46, 14 October 2014 diff hist +6,996 N IGEM team meeting notes 9/15/14 Created page with "Agenda 9/15/2014 Attendees: Advait (zoom), Patrik, Marc, Rachel, Maria, Thorson, Isaac, Rebecca, Ben, Moises, Jamie Call-in info: https://zoom.us/j/820128495 Or, go to https:..." current
- 21:45, 14 October 2014 diff hist +2,220 N IGEM team meeting notes 9/29/14 Created page with "= Meeting 9/29/2014 = regular RVC meeting and first ever board meeting at CCL; experiments being finished up at BioC Attendees: ? BioCurious: Maria, Lafia, Meenakshi, Nikola,..." current
- 21:44, 14 October 2014 diff hist +3,690 N IGEM team meeting notes 10/13/14 Created page with "= Meeting 10/13/2014 at CCL = Call-in info: https://zoom.us/j/820128495 Or, go to https://zoom.us/join and enter meeting ID: 820 128 495 hello is the zoom starting Attendees:..." current
- 21:44, 14 October 2014 diff hist +38 Real Vegan Cheese →Meeting notes
- 21:38, 14 October 2014 diff hist +185 Submitting 4 repeat and 1 new casein in pD1214 plasmid for sequencing 10Oct2014
- 18:18, 13 October 2014 diff hist 0 Submitting 4 repeat and 1 new casein in pD1214 plasmid for sequencing 10Oct2014
- 18:18, 13 October 2014 diff hist +1 Submitting 4 repeat and 1 new casein in pD1214 plasmid for sequencing 10Oct2014
- 18:18, 13 October 2014 diff hist +78 Submitting 4 repeat and 1 new casein in pD1214 plasmid for sequencing 10Oct2014
- 18:17, 13 October 2014 diff hist +15 N File:Sequencing data summary 10-11-14.png Sequencing Data current
- 02:30, 4 October 2014 diff hist +39 Real Vegan Cheese
- 15:35, 2 October 2014 diff hist +1 Submitting 10 casein and FAM20C in pD1214 plasmids for sequencing 30Sep2014
- 15:35, 2 October 2014 diff hist +6 Submitting 10 casein and FAM20C in pD1214 plasmids for sequencing 30Sep2014
- 15:34, 2 October 2014 diff hist +102 Shared Laboratory Notebook
- 23:46, 1 October 2014 diff hist 0 Submitting 10 casein and FAM20C in pD1214 plasmids for sequencing 30Sep2014
- 23:46, 1 October 2014 diff hist 0 Submitting 10 casein and FAM20C in pD1214 plasmids for sequencing 30Sep2014
- 23:46, 1 October 2014 diff hist +6 Submitting 10 casein and FAM20C in pD1214 plasmids for sequencing 30Sep2014
- 23:45, 1 October 2014 diff hist +109 Submitting 10 casein and FAM20C in pD1214 plasmids for sequencing 30Sep2014
- 23:44, 1 October 2014 diff hist 0 N File:Screen Shot 2014-10-01 at 4.42.46 PM.png current
- 11:49, 8 September 2014 diff hist +4 CLONE 082514 humKappaCasein(Kex+) →Experiment 082514_humKappaCasein(Kex+) Cloning
- 11:49, 8 September 2014 diff hist 0 File:HumanKappa(Kex+).png Craig uploaded a new version of "File:HumanKappa(Kex+).png" current
- 11:48, 8 September 2014 diff hist +2 CLONE 082514 humKappaCasein(Kex+)
- 11:48, 8 September 2014 diff hist +26 CLONE 082514 humKappaCasein(Kex+)
- 11:47, 8 September 2014 diff hist +32 CLONE 082514 humKappaCasein(Kex+)
- 11:46, 8 September 2014 diff hist 0 File:HumanKap(Kex+) Rev.png Craig uploaded a new version of "File:HumanKap(Kex+) Rev.png": Reverse direction sequencing. current
- 11:45, 8 September 2014 diff hist −32 CLONE 082514 humKappaCasein(Kex+)
- 11:44, 8 September 2014 diff hist +32 CLONE 082514 humKappaCasein(Kex+)
- 11:43, 8 September 2014 diff hist 0 File:HumanKap(Kex+) Rev.png Craig uploaded a new version of "File:HumanKap(Kex+) Rev.png"
- 11:42, 8 September 2014 diff hist −53 CLONE 082514 humKappaCasein(Kex+)
- 11:41, 8 September 2014 diff hist 0 CLONE 082514 humKappaCasein(Kex+)
- 11:39, 8 September 2014 diff hist +143 CLONE 082514 humKappaCasein(Kex+)
- 11:38, 8 September 2014 diff hist 0 N File:HumanKappa(Kex+).png
- 11:37, 8 September 2014 diff hist 0 N File:HumanKap(Kex+) Rev.png
- 06:54, 2 September 2014 diff hist +1 Shared Laboratory Notebook
- 03:44, 2 September 2014 diff hist +29 Shared Laboratory Notebook
- 03:40, 2 September 2014 diff hist +75 Shared Laboratory Notebook
- 03:39, 2 September 2014 diff hist +17 N Shared Laboratory Notebook Created page with "*DNA Handling"
- 03:39, 2 September 2014 diff hist +32 Real Vegan Cheese
- 17:56, 30 August 2014 diff hist +4 CLONE 082514 humKappaCasein(Kex+)
- 17:56, 30 August 2014 diff hist +33 CLONE 082514 humKappaCasein(Kex+) →Experiment 082514_humKappaCasein(Kex+) Cloning
- 17:54, 30 August 2014 diff hist 0 N File:Human Kappa Casein Map.png current
- 17:51, 30 August 2014 diff hist +2,162 N CLONE 082514 humKappaCasein(Kex+) Created page with "== Experiment 082514_humKappaCasein(Kex+) Cloning == *Human Kappa Casein (BB.SapI.humKappa(Kex+).SapI.BB) 5'- TACACGGAATTCGCGGCCGCTTCTAGAGGCTCTTCTATGAGATTCCCATCTATTTTCACC..."
- 17:51, 30 August 2014 diff hist +3 Cloning strategy →Experiments
- 17:50, 30 August 2014 diff hist −2 CR 082514 humKappaCasein(Kex+) →Experiment CR082514_humKappaCasein(Kex+) Cloning current
- 17:49, 30 August 2014 diff hist +2,164 N CR 082514 humKappaCasein(Kex+) Created page with "== Experiment CR082514_humKappaCasein(Kex+) Cloning == *Human Kappa Casein (BB.SapI.humKappa(Kex+).SapI.BB) 5'- TACACGGAATTCGCGGCCGCTTCTAGAGGCTCTTCTATGAGATTCCCATCTATTTTCA..."
- 17:43, 30 August 2014 diff hist +3,867 N CR 062214 humanKappaCasein 001 Created page with "== Experiment CR062214_hKappa Casein Cloning == *The sequence has been delivered! 5' - TACACGTACTTAGTCGCTGAAGCTCTTCT'''ATG'''GAAGTCCAAAACCAAAAGCAACCAGCTTGTCATGAAAACGACGAAAG..." current
- 17:43, 30 August 2014 diff hist +45 Cloning strategy →Experiments
- 17:41, 30 August 2014 diff hist −44 Cloning strategy Undo revision 495 by Craig (talk)