User contributions for Craig

(newest | oldest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)

• 11:46, 8 September 2014 diff hist 0‎ File:HumanKap(Kex+) Rev.png ‎ Craig uploaded a new version of "File:HumanKap(Kex+) Rev.png": Reverse direction sequencing. current
• 11:45, 8 September 2014 diff hist −32‎ CLONE 082514 humKappaCasein(Kex+) ‎
• 11:44, 8 September 2014 diff hist +32‎ CLONE 082514 humKappaCasein(Kex+) ‎
• 11:43, 8 September 2014 diff hist 0‎ File:HumanKap(Kex+) Rev.png ‎ Craig uploaded a new version of "File:HumanKap(Kex+) Rev.png"
• 11:42, 8 September 2014 diff hist −53‎ CLONE 082514 humKappaCasein(Kex+) ‎
• 11:41, 8 September 2014 diff hist 0‎ CLONE 082514 humKappaCasein(Kex+) ‎
• 11:39, 8 September 2014 diff hist +143‎ CLONE 082514 humKappaCasein(Kex+) ‎
• 11:38, 8 September 2014 diff hist 0‎ N File:HumanKappa(Kex+).png ‎
• 11:37, 8 September 2014 diff hist 0‎ N File:HumanKap(Kex+) Rev.png ‎
• 06:54, 2 September 2014 diff hist +1‎ Shared Laboratory Notebook ‎
• 03:44, 2 September 2014 diff hist +29‎ Shared Laboratory Notebook ‎
• 03:40, 2 September 2014 diff hist +75‎ Shared Laboratory Notebook ‎
• 03:39, 2 September 2014 diff hist +17‎ N Shared Laboratory Notebook ‎ Created page with "*DNA Handling"
• 03:39, 2 September 2014 diff hist +32‎ Real Vegan Cheese ‎
• 17:56, 30 August 2014 diff hist +4‎ CLONE 082514 humKappaCasein(Kex+) ‎
• 17:56, 30 August 2014 diff hist +33‎ CLONE 082514 humKappaCasein(Kex+) ‎ →‎Experiment 082514_humKappaCasein(Kex+) Cloning
• 17:54, 30 August 2014 diff hist 0‎ N File:Human Kappa Casein Map.png ‎ current
• 17:51, 30 August 2014 diff hist +2,162‎ N CLONE 082514 humKappaCasein(Kex+) ‎ Created page with "== Experiment 082514_humKappaCasein(Kex+) Cloning == *Human Kappa Casein (BB.SapI.humKappa(Kex+).SapI.BB) 5'- TACACGGAATTCGCGGCCGCTTCTAGAGGCTCTTCTATGAGATTCCCATCTATTTTCACC..."
• 17:51, 30 August 2014 diff hist +3‎ Cloning strategy ‎ →‎Experiments
• 17:50, 30 August 2014 diff hist −2‎ CR 082514 humKappaCasein(Kex+) ‎ →‎Experiment CR082514_humKappaCasein(Kex+) Cloning current
• 17:49, 30 August 2014 diff hist +2,164‎ N CR 082514 humKappaCasein(Kex+) ‎ Created page with "== Experiment CR082514_humKappaCasein(Kex+) Cloning == *Human Kappa Casein (BB.SapI.humKappa(Kex+).SapI.BB) 5'- TACACGGAATTCGCGGCCGCTTCTAGAGGCTCTTCTATGAGATTCCCATCTATTTTCA..."
• 17:43, 30 August 2014 diff hist +3,867‎ N CR 062214 humanKappaCasein 001 ‎ Created page with "== Experiment CR062214_hKappa Casein Cloning == *The sequence has been delivered! 5' - TACACGTACTTAGTCGCTGAAGCTCTTCT'''ATG'''GAAGTCCAAAACCAAAAGCAACCAGCTTGTCATGAAAACGACGAAAG..." current
• 17:43, 30 August 2014 diff hist +45‎ Cloning strategy ‎ →‎Experiments
• 17:41, 30 August 2014 diff hist −44‎ Cloning strategy ‎ Undo revision 495 by Craig (talk)
• 17:40, 30 August 2014 diff hist +44‎ Cloning strategy ‎ →‎Experiments
• 02:31, 30 August 2014 diff hist +584‎ N DNA Handling ‎ Created page with " Our cloning strategy requires 20ng of Casein-DNA in 1uL. This means we need a final concentration of DNA for cloning to be 20ng/uL. 1. Quick spin lyophilized DNA in a micro..."
• 02:26, 30 August 2014 diff hist +2‎ Cloning strategy ‎ →‎Experiments
• 02:26, 30 August 2014 diff hist +17‎ Cloning strategy ‎
• 16:26, 20 August 2014 diff hist −2‎ Cloning strategy ‎
• 16:25, 20 August 2014 diff hist +3,867‎ N Molecular Experiments ‎ Created page with "== Experiment CR062214_hKappa Casein Cloning == *The sequence has been delivered! 5' - TACACGTACTTAGTCGCTGAAGCTCTTCT'''ATG'''GAAGTCCAAAACCAAAAGCAACCAGCTTGTCATGAAAACGACGAAAG..." current
• 16:24, 20 August 2014 diff hist +43‎ Cloning strategy ‎
• 16:23, 20 August 2014 diff hist −3,850‎ Cloning strategy ‎ →‎hKappa Casein Cloning
• 16:23, 20 August 2014 diff hist +93‎ Growth Curve Experiment ‎
• 16:20, 20 August 2014 diff hist −4‎ Growth Curve Experiment ‎
• 16:19, 20 August 2014 diff hist +141‎ Growth Curve Experiment ‎
• 16:17, 20 August 2014 diff hist +13‎ Growth Curve Experiment ‎
• 16:16, 20 August 2014 diff hist +2‎ Growth Curve Experiment ‎
• 16:13, 20 August 2014 diff hist +391‎ Growth Curve Experiment ‎
• 16:04, 20 August 2014 diff hist +1,480‎ N Growth Curve Experiment ‎ Created page with "Chemical transformation of yeast requires the organism to be in logarithmic growth phase, so, before we clone our casein genes into yeast, we need to make sure that we know ho..."
• 16:00, 20 August 2014 diff hist −1,350‎ Microbiology ‎ Replaced content with "*Growth Curve Experiment" current
• 16:00, 20 August 2014 diff hist +1,359‎ Microbiology ‎
• 15:55, 20 August 2014 diff hist +19‎ N Microbiology ‎ Created page with "New Experiments"
• 15:55, 20 August 2014 diff hist +18‎ Real Vegan Cheese ‎
• 17:25, 8 August 2014 diff hist +231‎ Cloning strategy ‎ →‎hKappa Casein Cloning
• 04:52, 6 August 2014 diff hist +69‎ Working Groups ‎
• 04:50, 6 August 2014 diff hist −861‎ Working Groups ‎ →‎Budget, Inventory, Ordering
• 04:50, 6 August 2014 diff hist +33‎ Real Vegan Cheese ‎ →‎Project pages
• 04:07, 6 August 2014 diff hist +536‎ N IGEM cloning team meeting notes 8/05/14 ‎ Created page with "Meeting 08/05/14 Agenda (1) Strategy - Review of Milestones (2) Reagents needed (add to list below) (3) Sequencing - Rachel as point person for Sequetech (done) (4) Reporti..." current
• 04:07, 6 August 2014 diff hist +45‎ Real Vegan Cheese ‎ →‎Meeting notes
• 04:06, 6 August 2014 diff hist +145‎ External communications ‎

(newest | oldest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)