Difference between revisions of "Cloning strategy"

From Real Vegan Cheese
Jump to navigation Jump to search
 
(43 intermediate revisions by 4 users not shown)
Line 33: Line 33:


The shuttle vector will arrive linearized with overlaps for DNA 2.0's own Electra cloning system.
The shuttle vector will arrive linearized with overlaps for DNA 2.0's own Electra cloning system.
[[File:PD1214-FAKS.png|470px]] [[File:Pd1214-faks.jpg|350px]]
[[File:ElectrapDAUGHTERinsertion.png|828px]]


== Reagents ==
== Reagents ==
Line 107: Line 111:
We don't have the sequences yet!
We don't have the sequences yet!


=Experiments=
*[[DNA Handling]]
*[[CR_062214_humanKappaCasein_001]]
*[[CLONE_082514_humKappaCasein(Kex+)]]
=Progress summary, Milestones 1 & 2=
{| class="wikitable"
|- style="height: 40px;"
! gBlock gene construct
! Ordered, IDT
! Received, IDT
! Cloned into pD1214
shuttle vector
! Plasmid construct
transformed into ''E. coli''
! Plasmid prep
! Construct
sequence confirmed
! BioBrick Part Number
|-
| P.FAKS.bovAlphaS1.S
| Aug. 18, 2014
| Sep. 2, 2014
| Sep. 12, 2014
| Sep. 12, 2014
| Reprep. Oct. 3, 2014
Sep. 14, 2014
Ambig. seq. Resubmit
and/or reprep new clone/s.
| Oct. 13, 2014
| BBa_K1531000
|-
| P.FAKS.bovAlphaS2(Kex+).S
| Aug. 18, 2014
| Sep. 2, 2014
| Sep. 12, 2014
| Sep. 12, 2014
| Reprep. Oct. 3, 2014


== hKappa Casein Cloning ==
Sep. 14, 2014
*The sequence has been delivered!
Wrong seq. Reprep
new clone/s.
| Oct. 13, 2014
| BBa_K1531001
|-
| P.FAKS.bovAlphaS2(Kex-).S
| Aug. 18, 2014
| Sep. 1, 2014
| Sep. 12, 2014
| Sep. 12, 2014
| Sep. 14, 2014
| Oct. 1, 2014
| BBa_K1531002
|-
| P.FAKS.Beta(A2).S (bov)
| Aug. 18, 2014
| Sep. 2, 2014
| Sep. 12, 2014
| Sep. 12, 2014
| Reprep. Oct. 3, 2014


  5' - TACACGTACTTAGTCGCTGAAGCTCTTCT'''ATG'''GAAGTCCAAAACCAAAAGCAACCAGCTTGTCATGAAAACGACGAAAGA
Sep. 14, 2014
CCATTCTACCAAAAGACTGCCCCATACGTTCCAATGTACTACGTTCCAAACTCTTACCCATACTACGGTACTAACTTGTA
Ambig. seq. Resubmit
CCAAAGAAGACCTGCTATCGCCATTAACAACCCATACGTCCCAAGAACTTACTACGCTAATCCAGCTGTTGTTCGTCCAC
ACGCTCAAATTCCACAAAGACAATATTTGCCTAACTCTCACCCACCAACCGTTGTCAGAAGACCAAACTTGCATCCTTCT
TTCATCGCTATCCCACCAAAAAAGATCCAAGACAAGATTATCATCCCAACTATCAACACTATCGCCACCGTTGAACCAAC
CCCAGCTCCTGCCACCGAACCAACTGTCGATTCTGTTGTTACTCCAGAAGCTTTCTCCGAATCTATCATTACTTCTACTC
CAGAAACTACCACTGTCGCCGTCACCCCACCAACTGCT'''GGT'''AGAAGAGCCGTCAATCGAGTTCGTACCA - 3'


*This sequence has 5' and 3' SapI sequences which will be cleaved during Electra cloning into vector pD1214-FAKS. This vector was ordered from DNA2.0 and is linearized upon arrival. Our insert is treated with Electra enzyme mix which cuts and ligates our SapI.kCasein.SapI gene and inserts it into the pD1214 vector.
and/or reprep new clone/s.
| Oct. 13, 2014
| BBa_K1531003
|-
| P.FAKS.bovBeta(B).S
| Aug. 18, 2014
| Sep. 16, 2014
| Sep. 27, 2014
| Sep. 27, 2014
| Sep. 29, 2014
| Oct. 1, 2014
| [http://parts.igem.org/Part:BBa_K1531004 BBa_K1531004]
|-
| P.FAKS.bovKappa.S
| Aug. 18, 2014
| Sep. 2, 2014
| Sep. 12, 2014
| Sep. 12, 2014
| Sep. 14, 2014
| Oct. 1, 2014
| [http://parts.igem.org/Part:BBa_K1531005 BBa_K1531005]
|-style="height: 40px;"
| P.FAKS.humAlphaS1.S
| Aug. 18, 2014
Redesigned & ordered


*SapI treated DNA has an ATG overhang at the 5' end and a GGT overhang at the 3' end. Our complete vector will have the alphafactorfull signal sequence, which leads into another Methionine (M), followed by the rest of the human kappa casein protein.
Sep. 26, 2014
| Oct. 3, 2014
(Sep. 26 order)


[https://www.dna20.com/products/expression-vectors/electra-system#2 All you need to know about the Electra system.]
IDT synth. FAIL


'''June 22, 2014'''
Sep. 4, 2014
* Successfully cloned SapI.hKcasein.SapI into the electra daughter vector (pD1214:FAKS).
| Oct. 4, 2014
Reaction:  
| Oct. 4, 2014
1uL pD1214:FAKS (20ng)
| Oct. 9, 2014(?)
1uL (20ng) of SapI.hkCasein.SapI
| Oct. 13, 2014
2uL Electra Buffer
| BBa_K1531006
1uL of Electra enzyme mix
|-style="height: 40px;"
15uL of Water
| P.FAKS.humBeta.S
----
| Aug. 18, 2014
20uL, Room Temperature, 20min.
| Sep. 2, 2014
| Sep. 12, 2014
Sep. 15, 2014


* Transformed 2uL in 20uL of NEB C3019 cells or 4uL into 40uL NEB C3019 cells (equivalent to E. cloni 10G - donated from NEB!)
= Rxn repeat
''in a 200uL thin-walled PCR tube, add''
| Sep. 12, 2014 = Rxn fail
2 or 4uL of DNA ligation mix
Sep. 14, 2014 = Rxn fail
20 or 40uL of Cells (on ICE!)
Allow DNA to incubate with Cells for 10min on ice
Heat shock cells at 42C for 45seconds using OpenPCR Machine (donated by open PCR)
Ice cells for 2 minutes
Add 100uL of LB (or SOC) and incubate cells for 60min at 37C on the Open PCR machine.
Plate 1/2 of each reaction onto two separate LB Carbenicillin (100ug/mL) plates and incubate overnight at 37C.


'''June 23, 2014'''
Sep. 15, 2014 = + colonies
*Selected 10 colonies and grew them overnight in LB-Carb (100ug/mL) in the 37C water bath.
| Sep. 17, 2014 prep
*Grew up 4, 2-ml Tubes of pUC19 (Lb, Carb)
of Sep. 15 tfm
*Grew up 5, 2-ml Tubes of pYEP24 (LB carb)
| Oct. 1, 2014
| BBa_K1531007
|-
| P.FAKS.humKappa(Kex+).S
| Aug. 18, 2014
| Aug. 25, 2014
| Aug. 25, 2014
| Aug. 26, 2014
| Aug. 27, 2014
| Sep. 6, 2014
| BBa_K1531008
|-
| P.FAKS.humKappa(Kex-).S
| Aug. 18, 2014
| Sep. 1, 2014
| Sep. 12, 2014
| Sep. 12, 2014
| Reprep. Oct. 4, 2014


1 colony per tube.
Sep. 14, 2014
2mL of LB+Carb (100ug/mL) in 5mL Falcon Tubes
Wrong seq. Reprep


'''June 24, 2014'''
new clone/s.
*Plasmid Prep'd all of the plasmids using the VIOGENE Mini Plus plasmid preparation kit.
|
[[File:20110829170206GF p.pdf]]
| BBa_K1531009
|-
| Sap.FAKS.hFam20C(Kex+).Sap
| Aug. 18, 2014
| Sep. 16, 2014
| Sep. 27, 2014
| Sep. 27, 2014
| Sep. 29, 2014
|
| BBa_K1531010
|-
| Sap.Faks.hFam20C(Kex-).Sap
| Aug. 18, 2014
| Sep. 24, 2014
| Sep. 27, 2014
| Sep. 27, 2014
| Sep. 29, 2014
| Oct. 15, 2014
| BBa_K1531011
|}

Latest revision as of 07:06, 16 October 2014

Milestone

Our first milestone will be to express and secrete full-length kappa-casein in S. cerevisiae. We only get one discounted order of gBlocks from IDT so we will save that for later milestones and pay full price for the initial kappa-casein synthesis.

Once the first milestone has been accomplished, we will attempt express

Orders for first milestone

E. coli

  • E. coli NEB-10: We have this strain available in our freezer.

S. cerevisiae

  • The strain must be a URA3 knockout: We are requesting a donation from NEB

Shuttle vector

The shuttle vector is a vector that can be grown and selected in E. coli and S. cerevisiae, but which only correctly expresses the gene or genes of interest in S. cerevisiae.

We're ordering the pD1214-FAKS shuttle vector from DNA 2.0 which contains the following features:

  • AmpR: Ampicillin resistance gene (for selection in E. coli)
  • P-Amp: Constitutive promoter for AmpR
  • pUCori: High copy number E. coli origin of replication
  • 2um: High copy number S. cerevisiae origin of replication from 2-μm plasmid.
  • URA3: Yeast selectable marker. Requires the use of an S. cerevisiae strain missing the URA3 gene.
  • P_ura: Constitutive S. cerevisiae promoter for URA3
  • T_ura: S. cerevisiae terminator for URA3
  • P_TEF1_syn: Constitutive S. cerevisiae promoter for our gene of interest (we will swap this out for an inducible promoter later)
  • Secretion signal: Full alpha-factor yeast secretion signal. Fused to our gene of interest to secrete the protein.
  • CYC1terminator: S. cerevisiae terminator for our gene of interest.

The shuttle vector will arrive linearized with overlaps for DNA 2.0's own Electra cloning system.

PD1214-FAKS.png Pd1214-faks.jpg

ElectrapDAUGHTERinsertion.png

Reagents

Since we are using the DNA2.0 Elektra System to clone full-length Kappa-Casein, our reagents list is significantly shorter! Here it is:

Cloning Elektra Vector (Craig Donated) Elektra System (Craig Donated)

E. coli Cloning Carbenicillin (50mg/mL, 25mL) donated by Teknova LB Broth (1L) donated by Teknova LB Carb 50Plates (20) donated by Teknova NEB 10-beta Competent E. coli (High Efficiency)

Genes SapI.KappaCasein.SapI (human) (Craig Donated)

Saccharomyces Expression Saccharomyces cerevisae (Ura3ko)? UV-sensitive, other muts LiOAC (250kg) PEG (500mL, 50%) YPD Plates + uridine (Ura3- growth) YPD Plates (Ura3+ selection; animal free) YPD Broth + Uridine (80ug/mL; 25 tubes/rack) YPD Broth (animal Free Soytone, 1000mL) donated by Teknova

PPE Sterile Nitrile gloves (50/box) Sterile Nitrile gloves (50/box) Biohazard Bags

Consumables 20uL Pipette Tips 200uL Pipette tips 1000uL Tips 1.5mL Eppendorf PCR tubes Plasmid miniPrep


Orders for second milestone

This is a work in progress. So far we're planning a large order of gBlocks from IDT including at least some of the following sequences:

Bovine:

  • Full-length bovine κ Casein
    • B genetic variant AAQ87923.1
  • Full-length bovine αs1 Casein
    • C genetic variant ACG63494.1
  • Full-length bovine αs2 Casein
    • A variant P02663
  • Full-length bovine β Casein
    • A2 genetic variant for health benefit P02666.2
    • B genetic variant for better coagulation AAI11173.1

Human:

  • Full-length human κ Casein P07498.3
  • Full-length human αs1 Casein
    • P47710.1
  • (There is no human αs2a Casein, just two truncated pseudogenes)
  • Full-length human β Casein
    • P05814.4
  • human caseinomacropeptide (why?)
  • FAM20C Kinase
    • Q8IXL6

Whale:

We don't have the sequences yet!

Experiments


Progress summary, Milestones 1 & 2

gBlock gene construct Ordered, IDT Received, IDT Cloned into pD1214

shuttle vector

Plasmid construct

transformed into E. coli

Plasmid prep Construct

sequence confirmed

BioBrick Part Number
P.FAKS.bovAlphaS1.S Aug. 18, 2014 Sep. 2, 2014 Sep. 12, 2014 Sep. 12, 2014 Reprep. Oct. 3, 2014

Sep. 14, 2014 Ambig. seq. Resubmit

and/or reprep new clone/s.

Oct. 13, 2014 BBa_K1531000
P.FAKS.bovAlphaS2(Kex+).S Aug. 18, 2014 Sep. 2, 2014 Sep. 12, 2014 Sep. 12, 2014 Reprep. Oct. 3, 2014

Sep. 14, 2014 Wrong seq. Reprep

new clone/s.

Oct. 13, 2014 BBa_K1531001
P.FAKS.bovAlphaS2(Kex-).S Aug. 18, 2014 Sep. 1, 2014 Sep. 12, 2014 Sep. 12, 2014 Sep. 14, 2014 Oct. 1, 2014 BBa_K1531002
P.FAKS.Beta(A2).S (bov) Aug. 18, 2014 Sep. 2, 2014 Sep. 12, 2014 Sep. 12, 2014 Reprep. Oct. 3, 2014

Sep. 14, 2014 Ambig. seq. Resubmit

and/or reprep new clone/s.

Oct. 13, 2014 BBa_K1531003
P.FAKS.bovBeta(B).S Aug. 18, 2014 Sep. 16, 2014 Sep. 27, 2014 Sep. 27, 2014 Sep. 29, 2014 Oct. 1, 2014 BBa_K1531004
P.FAKS.bovKappa.S Aug. 18, 2014 Sep. 2, 2014 Sep. 12, 2014 Sep. 12, 2014 Sep. 14, 2014 Oct. 1, 2014 BBa_K1531005
P.FAKS.humAlphaS1.S Aug. 18, 2014

Redesigned & ordered

Sep. 26, 2014

Oct. 3, 2014

(Sep. 26 order)

IDT synth. FAIL

Sep. 4, 2014

Oct. 4, 2014 Oct. 4, 2014 Oct. 9, 2014(?) Oct. 13, 2014 BBa_K1531006
P.FAKS.humBeta.S Aug. 18, 2014 Sep. 2, 2014 Sep. 12, 2014

Sep. 15, 2014

= Rxn repeat

Sep. 12, 2014 = Rxn fail

Sep. 14, 2014 = Rxn fail

Sep. 15, 2014 = + colonies

Sep. 17, 2014 prep

of Sep. 15 tfm

Oct. 1, 2014 BBa_K1531007
P.FAKS.humKappa(Kex+).S Aug. 18, 2014 Aug. 25, 2014 Aug. 25, 2014 Aug. 26, 2014 Aug. 27, 2014 Sep. 6, 2014 BBa_K1531008
P.FAKS.humKappa(Kex-).S Aug. 18, 2014 Sep. 1, 2014 Sep. 12, 2014 Sep. 12, 2014 Reprep. Oct. 4, 2014

Sep. 14, 2014 Wrong seq. Reprep

new clone/s.

BBa_K1531009
Sap.FAKS.hFam20C(Kex+).Sap Aug. 18, 2014 Sep. 16, 2014 Sep. 27, 2014 Sep. 27, 2014 Sep. 29, 2014 BBa_K1531010
Sap.Faks.hFam20C(Kex-).Sap Aug. 18, 2014 Sep. 24, 2014 Sep. 27, 2014 Sep. 27, 2014 Sep. 29, 2014 Oct. 15, 2014 BBa_K1531011
Retrieved from "http://wiki.realvegancheese.org/w/index.php?title=Cloning_strategy&oldid=858"