User contributions for Craig
Jump to navigation
Jump to search
- 17:40, 30 August 2014 diff hist +44 Cloning strategy →Experiments
- 02:31, 30 August 2014 diff hist +584 N DNA Handling Created page with " Our cloning strategy requires 20ng of Casein-DNA in 1uL. This means we need a final concentration of DNA for cloning to be 20ng/uL. 1. Quick spin lyophilized DNA in a micro..."
- 02:26, 30 August 2014 diff hist +2 Cloning strategy →Experiments
- 02:26, 30 August 2014 diff hist +17 Cloning strategy
- 16:26, 20 August 2014 diff hist −2 Cloning strategy
- 16:25, 20 August 2014 diff hist +3,867 N Molecular Experiments Created page with "== Experiment CR062214_hKappa Casein Cloning == *The sequence has been delivered! 5' - TACACGTACTTAGTCGCTGAAGCTCTTCT'''ATG'''GAAGTCCAAAACCAAAAGCAACCAGCTTGTCATGAAAACGACGAAAG..." current
- 16:24, 20 August 2014 diff hist +43 Cloning strategy
- 16:23, 20 August 2014 diff hist −3,850 Cloning strategy →hKappa Casein Cloning
- 16:23, 20 August 2014 diff hist +93 Growth Curve Experiment
- 16:20, 20 August 2014 diff hist −4 Growth Curve Experiment
- 16:19, 20 August 2014 diff hist +141 Growth Curve Experiment
- 16:17, 20 August 2014 diff hist +13 Growth Curve Experiment
- 16:16, 20 August 2014 diff hist +2 Growth Curve Experiment
- 16:13, 20 August 2014 diff hist +391 Growth Curve Experiment
- 16:04, 20 August 2014 diff hist +1,480 N Growth Curve Experiment Created page with "Chemical transformation of yeast requires the organism to be in logarithmic growth phase, so, before we clone our casein genes into yeast, we need to make sure that we know ho..."
- 16:00, 20 August 2014 diff hist −1,350 Microbiology Replaced content with "*Growth Curve Experiment" current
- 16:00, 20 August 2014 diff hist +1,359 Microbiology
- 15:55, 20 August 2014 diff hist +19 N Microbiology Created page with "New Experiments"
- 15:55, 20 August 2014 diff hist +18 Real Vegan Cheese
- 17:25, 8 August 2014 diff hist +231 Cloning strategy →hKappa Casein Cloning