Difference between revisions of "Cloning strategy"

From Real Vegan Cheese
Jump to navigation Jump to search
Line 33: Line 33:


The shuttle vector will arrive linearized with overlaps for DNA 2.0's own Electra cloning system.
The shuttle vector will arrive linearized with overlaps for DNA 2.0's own Electra cloning system.
[[File:PD1214-FAKS.png]]


== Reagents ==
== Reagents ==

Revision as of 08:55, 12 August 2014

Milestone

Our first milestone will be to express and secrete full-length kappa-casein in S. cerevisiae. We only get one discounted order of gBlocks from IDT so we will save that for later milestones and pay full price for the initial kappa-casein synthesis.

Once the first milestone has been accomplished, we will attempt express

Orders for first milestone

E. coli

  • E. coli NEB-10: We have this strain available in our freezer.

S. cerevisiae

  • The strain must be a URA3 knockout: We are requesting a donation from NEB

Shuttle vector

The shuttle vector is a vector that can be grown and selected in E. coli and S. cerevisiae, but which only correctly expresses the gene or genes of interest in S. cerevisiae.

We're ordering the pD1214-FAKS shuttle vector from DNA 2.0 which contains the following features:

  • AmpR: Ampicillin resistance gene (for selection in E. coli)
  • P-Amp: Constitutive promoter for AmpR
  • pUCori: High copy number E. coli origin of replication
  • 2um: High copy number S. cerevisiae origin of replication from 2-μm plasmid.
  • URA3: Yeast selectable marker. Requires the use of an S. cerevisiae strain missing the URA3 gene.
  • P_ura: Constitutive S. cerevisiae promoter for URA3
  • T_ura: S. cerevisiae terminator for URA3
  • P_TEF1_syn: Constitutive S. cerevisiae promoter for our gene of interest (we will swap this out for an inducible promoter later)
  • Secretion signal: Full alpha-factor yeast secretion signal. Fused to our gene of interest to secrete the protein.
  • CYC1terminator: S. cerevisiae terminator for our gene of interest.

The shuttle vector will arrive linearized with overlaps for DNA 2.0's own Electra cloning system.

PD1214-FAKS.png

Reagents

Since we are using the DNA2.0 Elektra System to clone full-length Kappa-Casein, our reagents list is significantly shorter! Here it is:

Cloning Elektra Vector (Craig Donated) Elektra System (Craig Donated)

E. coli Cloning Carbenicillin (50mg/mL, 25mL) donated by Teknova LB Broth (1L) donated by Teknova LB Carb 50Plates (20) donated by Teknova NEB 10-beta Competent E. coli (High Efficiency)

Genes SapI.KappaCasein.SapI (human) (Craig Donated)

Saccharomyces Expression Saccharomyces cerevisae (Ura3ko)? UV-sensitive, other muts LiOAC (250kg) PEG (500mL, 50%) YPD Plates + uridine (Ura3- growth) YPD Plates (Ura3+ selection; animal free) YPD Broth + Uridine (80ug/mL; 25 tubes/rack) YPD Broth (animal Free Soytone, 1000mL) donated by Teknova

PPE Sterile Nitrile gloves (50/box) Sterile Nitrile gloves (50/box) Biohazard Bags

Consumables 20uL Pipette Tips 200uL Pipette tips 1000uL Tips 1.5mL Eppendorf PCR tubes Plasmid miniPrep


Orders for second milestone

This is a work in progress. So far we're planning a large order of gBlocks from IDT including at least some of the following sequences:

Bovine:

  • Full-length bovine κ Casein
    • B genetic variant AAQ87923.1
  • Full-length bovine αs1 Casein
    • C genetic variant ACG63494.1
  • Full-length bovine αs2 Casein
    • A variant P02663
  • Full-length bovine β Casein
    • A2 genetic variant for health benefit P02666.2
    • B genetic variant for better coagulation AAI11173.1

Human:

  • Full-length human κ Casein P07498.3
  • Full-length human αs1 Casein
    • P47710.1
  • (There is no human αs2a Casein, just two truncated pseudogenes)
  • Full-length human β Casein
    • P05814.4
  • human caseinomacropeptide (why?)
  • FAM20C Kinase
    • Q8IXL6

Whale:

We don't have the sequences yet!


hKappa Casein Cloning

  • The sequence has been delivered!
 5' - TACACGTACTTAGTCGCTGAAGCTCTTCTATGGAAGTCCAAAACCAAAAGCAACCAGCTTGTCATGAAAACGACGAAAGA
CCATTCTACCAAAAGACTGCCCCATACGTTCCAATGTACTACGTTCCAAACTCTTACCCATACTACGGTACTAACTTGTA
CCAAAGAAGACCTGCTATCGCCATTAACAACCCATACGTCCCAAGAACTTACTACGCTAATCCAGCTGTTGTTCGTCCAC
ACGCTCAAATTCCACAAAGACAATATTTGCCTAACTCTCACCCACCAACCGTTGTCAGAAGACCAAACTTGCATCCTTCT
TTCATCGCTATCCCACCAAAAAAGATCCAAGACAAGATTATCATCCCAACTATCAACACTATCGCCACCGTTGAACCAAC
CCCAGCTCCTGCCACCGAACCAACTGTCGATTCTGTTGTTACTCCAGAAGCTTTCTCCGAATCTATCATTACTTCTACTC
CAGAAACTACCACTGTCGCCGTCACCCCACCAACTGCTGGTAGAAGAGCCGTCAATCGAGTTCGTACCA - 3'
  • This sequence has 5' and 3' SapI sequences which will be cleaved during Electra cloning into vector pD1214-FAKS. This vector was ordered from DNA2.0 and is linearized upon arrival. Our insert is treated with Electra enzyme mix which cuts and ligates our SapI.kCasein.SapI gene and inserts it into the pD1214 vector.
  • SapI treated DNA has an ATG overhang at the 5' end and a GGT overhang at the 3' end. Our complete vector will have the alphafactorfull signal sequence, which leads into another Methionine (M), followed by the rest of the human kappa casein protein.

All you need to know about the Electra system.

June 22, 2014

  • Successfully cloned SapI.hKcasein.SapI into the electra daughter vector (pD1214:FAKS).
Reaction: 
1uL pD1214:FAKS (20ng)
1uL (20ng) of SapI.hkCasein.SapI
2uL Electra Buffer
1uL of Electra enzyme mix
15uL of Water
----
20uL, Room Temperature, 20min.
  • Transformed 2uL in 20uL of NEB C3019 cells or 4uL into 40uL NEB C3019 cells (equivalent to E. cloni 10G - donated from NEB!)
in a 200uL thin-walled PCR tube, add
2 or 4uL of DNA ligation mix
20 or 40uL of Cells (on ICE!)
Allow DNA to incubate with Cells for 10min on ice
Heat shock cells at 42C for 45seconds using OpenPCR Machine (donated by open PCR)
Ice cells for 2 minutes
Add 100uL of LB (or SOC) and incubate cells for 60min at 37C on the Open PCR machine.
Plate 1/2 of each reaction onto two separate LB Carbenicillin (100ug/mL) plates and incubate overnight at 37C.

June 23, 2014

  • Selected 10 colonies and grew them overnight in LB-Carb (100ug/mL) in the 37C water bath.
  • Grew up 4, 2-ml Tubes of pUC19 (Lb, Carb)
  • Grew up 5, 2-ml Tubes of pYEP24 (LB carb)
1 colony per tube.
2mL of LB+Carb (100ug/mL) in 5mL Falcon Tubes

June 24, 2014

  • Plasmid Prep'd all of the plasmids using the VIOGENE Mini Plus plasmid preparation kit.

File:20110829170206GF p.pdf

August 6, 2014

  • Sending off plasmid pD1214:hCK - BD #1, BD#2, BD#3 to be sequenced in two reactions. Forward reaction is what primer alpha-factor 146 forward and reverse PMYR3. PMYR3 is an in-house primer at Sequetech. Sequetech is synthesizing primer alpha-factor 146 forward to be maintained in house at Sequetech for future reactions.
Primer Sequences
PMYR3: 5' CTTCCTTTTCGGTTAGAG 3' 
 Binds to the terminator (CYC1) and reads through int he 3'-5' direction (C-terminus of casein)

Alpha-factor 146-forward: 5' ACGTCGCTGTTTTGCC 3'
 Binds to the alpha factor and reads through 5'-3' of casein (N-terminus of Casein)

We had Sequetech in Mountain View do the sequencing. They pick up your sequences from whichever location you specify and have fast turnaround (~24 hours?). You simply tell them the primer sequences you want to use. They already had the PMYR3 sequence in their library and the other one they just synthesized for us.

August 8, 2014

  • All pD1214:hKcasein clones sequenced positive for human kappa casein in both the forward and reverse directions!
  • Files have been uploaded to Seafile under the directories Sequencing Files>Human Kappa Casein