Difference between revisions of "CR 082514 humKappaCasein(Kex+)"

From Real Vegan Cheese
Jump to navigation Jump to search
(Created page with "== Experiment CR082514_humKappaCasein(Kex+) Cloning == *Human Kappa Casein (BB.SapI.humKappa(Kex+).SapI.BB) 5'- TACACGGAATTCGCGGCCGCTTCTAGAGGCTCTTCTATGAGATTCCCATCTATTTTCA...")
 
 
Line 1: Line 1:
== Experiment CR082514_humKappaCasein(Kex+) Cloning ==
== Experiment 082514_humKappaCasein(Kex+) Cloning ==
*Human Kappa Casein (BB.SapI.humKappa(Kex+).SapI.BB)
*Human Kappa Casein (BB.SapI.humKappa(Kex+).SapI.BB)



Latest revision as of 17:50, 30 August 2014

Experiment 082514_humKappaCasein(Kex+) Cloning

  • Human Kappa Casein (BB.SapI.humKappa(Kex+).SapI.BB)
 5'- 
TACACGGAATTCGCGGCCGCTTCTAGAGGCTCTTCTATGAGATTCCCATCTATTTTCACCGCTGTCTTGTTCGCTGCCTCCTCTGCATTGGCTGCCCCTGTTAAC
ACTACCACTGAAGACGAGACTGCTCAAATTCCAGCTGAAGCAGTTATCGGTTACTCTGACCTTGAGGGTGATTTCGACGTCGCTGTTTTGCCTTTCTCTAACTCC
ACTAACAACGGTTTGTTGTTCATTAACACCACTATCGCTTCCATTGCTGCTAAGGAAGAGGGTGTCTCTCTCGAGAAAAGAGAGGCCGAAGCTGAAGTCCAAAAC
CAAAAGCAACCAGCTTGTCATGAAAACGACGAAAGACCATTCTACCAAAAGACTGCCCCATACGTTCCAATGTACTACGTTCCAAACTCTTACCCATACTACGGT
ACTAACTTGTACCAAAGAAGACCTGCTATCGCCATTAACAACCCATACGTCCCAAGAACTTACTACGCTAATCCAGCTGTTGTTCGTCCACACGCTCAAATTCCA
CAAAGACAATATTTGCCTAACTCTCACCCACCAACCGTTGTCAGAAGACCAAACTTGCATCCTTCTTTCATCGCTATCCCACCAAAAAAGATCCAAGACAAGATT
ATCATCCCAACTATCAACACTATCGCCACCGTTGAACCAACCCCAGCTCCTGCCACCGAACCAACTGTCGATTCTGTTGTTACTCCAGAAGCTTTCTCCGAATCT
ATCATTACTTCTACTCCAGAAACTACCACTGTCGCCGTCACCCCACCAACTGCTTAGGGTAGAAGAGCTACTAGTAGCGGCCGCTGCAGGTACCA - 3'
  • This sequence has 5' and 3' SapI sequences, followed by full length FAKS, followed by human Kappa Casein (Kex+). Electra cloning cleaves at SapI sites and ligates simulatenously.
  • We cloned into pD1214. This vector was ordered from DNA2.0 and is linearized upon arrival. Our insert is treated with Electra enzyme mix which cuts and ligates our "SapI.gene.SapI" and inserts it into the pD1214 vector.
  • SapI treated DNA has an ATG overhang at the 5' end and a GGT overhang at the 3' end. Our complete vector will have the alphafactorfull signal sequence, which leads into another Methionine (M), followed by the rest of the human kappa casein protein.

All you need to know about the Electra system.

August 25, 2014

  • Successfully cloned SapI.hKcasein.SapI into the electra daughter vector (pD1214).
Reaction: 
1uL pD1214:FAKS (20ng)
1uL (20ng) of BB.SapI.humKappa(Kex+).SapI.BB
2uL Electra Buffer
1uL of Electra enzyme mix
15uL of Water
----
20uL, Room Temperature, 20min.
  • We waited to transform cells until August 26, 2014 (Nikola and Johan performed this) since we did not have competent cells available.