User contributions for Craig
Jump to navigation
Jump to search
- 17:40, 30 August 2014 diff hist +44 Cloning strategy →Experiments
- 02:31, 30 August 2014 diff hist +584 N DNA Handling Created page with " Our cloning strategy requires 20ng of Casein-DNA in 1uL. This means we need a final concentration of DNA for cloning to be 20ng/uL. 1. Quick spin lyophilized DNA in a micro..."
- 02:26, 30 August 2014 diff hist +2 Cloning strategy →Experiments
- 02:26, 30 August 2014 diff hist +17 Cloning strategy
- 16:26, 20 August 2014 diff hist −2 Cloning strategy
- 16:25, 20 August 2014 diff hist +3,867 N Molecular Experiments Created page with "== Experiment CR062214_hKappa Casein Cloning == *The sequence has been delivered! 5' - TACACGTACTTAGTCGCTGAAGCTCTTCT'''ATG'''GAAGTCCAAAACCAAAAGCAACCAGCTTGTCATGAAAACGACGAAAG..." current
- 16:24, 20 August 2014 diff hist +43 Cloning strategy
- 16:23, 20 August 2014 diff hist −3,850 Cloning strategy →hKappa Casein Cloning
- 16:23, 20 August 2014 diff hist +93 Growth Curve Experiment
- 16:20, 20 August 2014 diff hist −4 Growth Curve Experiment
- 16:19, 20 August 2014 diff hist +141 Growth Curve Experiment
- 16:17, 20 August 2014 diff hist +13 Growth Curve Experiment
- 16:16, 20 August 2014 diff hist +2 Growth Curve Experiment
- 16:13, 20 August 2014 diff hist +391 Growth Curve Experiment
- 16:04, 20 August 2014 diff hist +1,480 N Growth Curve Experiment Created page with "Chemical transformation of yeast requires the organism to be in logarithmic growth phase, so, before we clone our casein genes into yeast, we need to make sure that we know ho..."
- 16:00, 20 August 2014 diff hist −1,350 Microbiology Replaced content with "*Growth Curve Experiment" current
- 16:00, 20 August 2014 diff hist +1,359 Microbiology
- 15:55, 20 August 2014 diff hist +19 N Microbiology Created page with "New Experiments"
- 15:55, 20 August 2014 diff hist +18 Real Vegan Cheese
- 17:25, 8 August 2014 diff hist +231 Cloning strategy →hKappa Casein Cloning
- 04:52, 6 August 2014 diff hist +69 Working Groups
- 04:50, 6 August 2014 diff hist −861 Working Groups →Budget, Inventory, Ordering
- 04:50, 6 August 2014 diff hist +33 Real Vegan Cheese →Project pages
- 04:07, 6 August 2014 diff hist +536 N IGEM cloning team meeting notes 8/05/14 Created page with "Meeting 08/05/14 Agenda (1) Strategy - Review of Milestones (2) Reagents needed (add to list below) (3) Sequencing - Rachel as point person for Sequetech (done) (4) Reporti..." current
- 04:07, 6 August 2014 diff hist +45 Real Vegan Cheese →Meeting notes
- 04:06, 6 August 2014 diff hist +145 External communications
- 03:11, 6 August 2014 diff hist +771 Working Groups
- 03:07, 6 August 2014 diff hist +105 External communications
- 02:54, 6 August 2014 diff hist +10 Cloning strategy
- 02:53, 6 August 2014 diff hist +182 Cloning strategy
- 02:51, 6 August 2014 diff hist −3 Cloning strategy
- 02:51, 6 August 2014 diff hist +475 Cloning strategy
- 20:49, 4 August 2014 diff hist +8 External communications
- 20:49, 4 August 2014 diff hist +93 External communications
- 04:24, 25 June 2014 diff hist +32 Cloning strategy →hKappa Casein Cloning
- 04:23, 25 June 2014 diff hist +46 N File:20110829170206GF p.pdf Protocol for the VIOGENE plasmid plus prep kit
- 03:52, 25 June 2014 diff hist +965 Cloning strategy →hKappa Casein Cloning
- 03:36, 25 June 2014 diff hist +280 Cloning strategy →hKappa Casein Cloning
- 15:39, 20 June 2014 diff hist +368 Cloning strategy →hKappa Casein Cloning
- 15:31, 20 June 2014 diff hist +12 Cloning strategy →hKappa Casein Cloning
- 15:30, 20 June 2014 diff hist +4 Cloning strategy →hKappa Casein Cloning
- 15:30, 20 June 2014 diff hist +1 Cloning strategy →hKappa Casein Cloning
- 15:29, 20 June 2014 diff hist +2 Cloning strategy →hKappa Casein Cloning
- 15:29, 20 June 2014 diff hist 0 Cloning strategy →hKappa Casein Cloning
- 15:28, 20 June 2014 diff hist −1 Cloning strategy →hKappa Casein Cloning
- 15:28, 20 June 2014 diff hist +1,043 Cloning strategy
- 20:16, 10 June 2014 diff hist +2 Cloning strategy →E. coli
- 20:15, 10 June 2014 diff hist +681 Cloning strategy
- 20:12, 10 June 2014 diff hist +8 Cloning strategy →E. coli
- 03:22, 22 April 2014 diff hist +595 Cheese making →Books and resources