CR 062214 humanKappaCasein 001

Experiment CR062214_hKappa Casein Cloning

• The sequence has been delivered!

 5' - TACACGTACTTAGTCGCTGAAGCTCTTCTATGGAAGTCCAAAACCAAAAGCAACCAGCTTGTCATGAAAACGACGAAAGA
CCATTCTACCAAAAGACTGCCCCATACGTTCCAATGTACTACGTTCCAAACTCTTACCCATACTACGGTACTAACTTGTA
CCAAAGAAGACCTGCTATCGCCATTAACAACCCATACGTCCCAAGAACTTACTACGCTAATCCAGCTGTTGTTCGTCCAC
ACGCTCAAATTCCACAAAGACAATATTTGCCTAACTCTCACCCACCAACCGTTGTCAGAAGACCAAACTTGCATCCTTCT
TTCATCGCTATCCCACCAAAAAAGATCCAAGACAAGATTATCATCCCAACTATCAACACTATCGCCACCGTTGAACCAAC
CCCAGCTCCTGCCACCGAACCAACTGTCGATTCTGTTGTTACTCCAGAAGCTTTCTCCGAATCTATCATTACTTCTACTC
CAGAAACTACCACTGTCGCCGTCACCCCACCAACTGCTGGTAGAAGAGCCGTCAATCGAGTTCGTACCA - 3'

• This sequence has 5' and 3' SapI sequences which will be cleaved during Electra cloning into vector pD1214-FAKS. This vector was ordered from DNA2.0 and is linearized upon arrival. Our insert is treated with Electra enzyme mix which cuts and ligates our SapI.kCasein.SapI gene and inserts it into the pD1214 vector.

• SapI treated DNA has an ATG overhang at the 5' end and a GGT overhang at the 3' end. Our complete vector will have the alphafactorfull signal sequence, which leads into another Methionine (M), followed by the rest of the human kappa casein protein.

All you need to know about the Electra system.

June 22, 2014

• Successfully cloned SapI.hKcasein.SapI into the electra daughter vector (pD1214:FAKS).

Reaction: 
1uL pD1214:FAKS (20ng)
1uL (20ng) of SapI.hkCasein.SapI
2uL Electra Buffer
1uL of Electra enzyme mix
15uL of Water
----
20uL, Room Temperature, 20min.

• Transformed 2uL in 20uL of NEB C3019 cells or 4uL into 40uL NEB C3019 cells (equivalent to E. cloni 10G - donated from NEB!)

in a 200uL thin-walled PCR tube, add
2 or 4uL of DNA ligation mix
20 or 40uL of Cells (on ICE!)
Allow DNA to incubate with Cells for 10min on ice
Heat shock cells at 42C for 45seconds using OpenPCR Machine (donated by open PCR)
Ice cells for 2 minutes
Add 100uL of LB (or SOC) and incubate cells for 60min at 37C on the Open PCR machine.
Plate 1/2 of each reaction onto two separate LB Carbenicillin (100ug/mL) plates and incubate overnight at 37C.

June 23, 2014

• Selected 10 colonies and grew them overnight in LB-Carb (100ug/mL) in the 37C water bath.
• Grew up 4, 2-ml Tubes of pUC19 (Lb, Carb)
• Grew up 5, 2-ml Tubes of pYEP24 (LB carb)

1 colony per tube.
2mL of LB+Carb (100ug/mL) in 5mL Falcon Tubes

June 24, 2014

• Plasmid Prep'd all of the plasmids using the VIOGENE Mini Plus plasmid preparation kit.

File:20110829170206GF p.pdf

August 6, 2014

• Sending off plasmid pD1214:hCK - BD #1, BD#2, BD#3 to be sequenced in two reactions. Forward reaction is what primer alpha-factor 146 forward and reverse PMYR3. PMYR3 is an in-house primer at Sequetech. Sequetech is synthesizing primer alpha-factor 146 forward to be maintained in house at Sequetech for future reactions.

Primer Sequences
PMYR3: 5' CTTCCTTTTCGGTTAGAG 3' 
 Binds to the terminator (CYC1) and reads through int he 3'-5' direction (C-terminus of casein)

Alpha-factor 146-forward: 5' ACGTCGCTGTTTTGCC 3'
 Binds to the alpha factor and reads through 5'-3' of casein (N-terminus of Casein)

We had Sequetech in Mountain View do the sequencing. They pick up your sequences from whichever location you specify and have fast turnaround (~24 hours?). You simply tell them the primer sequences you want to use. They already had the PMYR3 sequence in their library and the other one they just synthesized for us.

August 8, 2014

• All pD1214:hKcasein clones sequenced positive for human kappa casein in both the forward and reverse directions!
• Files have been uploaded to Seafile under the directories Sequencing Files>Human Kappa Casein